Phenotypes
Omphallorhagia
No summary available.
Omphalocele
No summary available.
Osteoarthritis
No summary available.
Osteochondrodysplastic and cardiomyopathic syndrome
Jacinto et al. (2024): "Genetic analysis [of affected Chianina cattle] identified a missense variant in TGDS [ARS-UCD1.2:Chr12:69092831A>T; NM_001101159.1: c.160T>A; NP_001094629.1: p.Tyr54Asn] and a splice-site variant in LAMA4 [ARS-UCD1.2:Chr9:38176716GAGAAAGTGAGAGAGGGAAACAGAGGGGAGAGAGAA>G; XM_024996678.1:c.153_153 + 34delAGTGAGAGAGGGAAACAGAGGGGAGAGAGAAAGAA], both of which were homozygous in the 2 cases. Parents were heterozygous an...
Osteochondrosis
No summary available.
Osteodystrophy
No summary available.
Osteogenesis imperfecta, COL1A2-related
Jacinto et al. (2025) investigated two aborted half-sib Stabiliser calves with osteogenesis imperfecta. Whole genome sequencing identified a likely "heterozygous missense variant in exon 21 of [the functional candidate gene] COL1A2, located in the triple-helical region (Chr4:g.11792118G > A; c.1156G > A; p.Gly386Arg) [omia.variant:1837]. ... The variant may be a de novo mutation inherited from a germinal mosaic sire."
Osteogenesis imperfecta, generic
By genome sequencing an affected male Holstein calf and its parents, Zhang et al. (2020) were not able to identify a single likely causal variant, and concluded that this particular form of osteogenesis imperfecta may be oligogenic, i.e. multifactorial.Jacinto et al. (2025) conducted whole genome sequencing of a stillborn female Holstein calf with osteogenesis imperfecta and dentinogenesis imperfecta and it's sire and dam. Variant filtering fo...
Osteogenesis imperfecta, type II, COL1A1-related
Bourneuf et al. (2017): a de novo likely causal variant is COL1A1 p.1049_1050delinsS in Fleckvieh Petersen et al. (2019): "Whole-genome sequencing revealed the presence of a missense mutation in the alpha 1 chain of collagen Type I (COL1A1), for which both calves were heterozygous. The variant resulted in the substitution of a glycine residue with serine in the triple helical domain of the protein; in this region, glycine normally occupies eve...
Osteopetrosis
See also OMIA 002443-9913 : Osteopetrosis, SLC4A2-related in Bos taurus for this disease caused by a mutation in the SLC4A2 gene.
Osteopetrosis with gingival hamartomas
Comparison of whole-genome sequence by Sartelet et al. (2014), from four affecteds and eight control Belgian Blue non-carriers, revealed three SNVs "[c2244G>C + c2248T>C + c2250C>A] located in exon 23 of the CLCN7 gene encoding the anion transport protein ClC-7". The first of these is synonymous, but the second and third jointly cause "a tyrosine to glutamine substitution (TAC>CAA: Y750Q)" in a highly conserved region of the protei...
Osteopetrosis, DCAF12L2-related
Jacinto et al. (2025): "A female Angus x Holstein crossbred calf ... was pathologically diagnosed with a syndromic form of osteopetrosis. The [whole genome sequencing] trio-approach identified a heterozygous pathogenic stop-gained variant in exon 1 of LOC112445140, also known as DDB1- and CUL4-associated factor 12-like protein (ChrX: g.10872688G > T; c.332C > A; p.Ser111*) [omia.variant:1839]. We think that the variant arose post-zygotic...
Osteopetrosis, SLC4A2-related
No summary available.
Otitis interna, susceptibility to
No summary available.
Otitis media, susceptibility to
No summary available.